What is pEGFP N1?
pEGFP-N1 encodes a red-shifted variant of wild-type GFP (1–3) which has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 507 nm.) The MCS in pEGFP-N1 is between the immediate early promoter of CMV (PCMV IE) and the EGFP coding sequences.
What size is pEGFP N1?
Plasmid: pEGFP-N1
| Source/Vendor: | Clontech |
|---|---|
| Size: | 4700 |
| 5′ Sequencing 1 Primer: | CMV-F, EGFP-N |
| 5′ Sequencing 1 Primer Sequence: | 5’d[CGTCGCCGTCCAGCTCGACCAG]3′ |
| Tag 1: | EGFP (Cterm) |
What is F1 origin?
The ori is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells (Addgene). F1 is a phage-derived ori that allows for the replication and packaging of ssDNA into phage particles. Plasmids with phage-derived ori’s are referred to as phagemids.
What is a CMV promoter?
The CMV promoter is a commonly used promoter for the production of high level recombinant protein in mammalian cells17. However, the expression level of the transgene driven by CMV promoter decreases with extended culture times because of transcriptional silencing, which is associated with DNA methylation18, 19.
What is the difference between SnapGene and SnapGene viewer?
SnapGene Viewer includes the same rich visualization, annotation, and sharing capabilities as the fully enabled SnapGene software. SnapGene Viewer is revolutionary software that allows molecular biologists to create, browse, and share richly annotated DNA sequence files up to 1 Gbp in length.
What is a high copy plasmid?
In cellular biology, the plasmid copy number is the number of copies of a given plasmid in a cell. If a plasmid has too high of a copy number, they may excessively burden their host by occupying too much cellular machinery and using too much energy.
What is the excitation maximum of pegfp-n1?
(Excitation maximum = 488 nm; emission maximum = 507 nm.) pEGFP-N1 encodes the GFPmut1 variant which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the EGFP gene contains more than 190 silent base changes which correspond to human codon-usage preferences.
Where is pegfp-n1 located in the MCS?
pEGFP-N1 is between the immediate early promoter of CMV and the EGFP coding sequences. Genes cloned into the MCS will be expressed as fusions to the N-terminus of EGFP if they are in the same reading frame as EGFP and there are no intervening stop codons.
How is pegfp-n1 used as a transfection marker?
The recombinant EGFP vector can be transfected into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 (7). pEGFP-N1 can also be used simply to express EGFP in a cell line of interest (e.g., as a transfection marker).
Which is the vector for fusing eGFP to the C terminus?
pEGFP-N1. Vector for fusing EGFP to the C-terminus of a partner protein. For other reading frames, use pEGFP‑N2 or pEGFP‑N3. To see this sequence with restriction sites, features, and translations, please download SnapGene or the free SnapGene Viewer.
